Summary
| Resource Type | Gene |
|---|---|
| Accession | |
| Organism | |
| Name | Pa01g1564 |
| Identifier | Pa01g1564 |
| Is Analysis | No |
| Is Obsolete | No |
| Time Accessioned | Friday, October 2, 2026 - 18:03 |
| Time Last Modified | Friday, October 2, 2026 - 18:03 |
Sequences
| Sequence | ATGGATTCTGCAACTTCGATGGTGGCAGAGGCAGCTTTAAGTGCCCTTTT |
|---|---|
| Sequence Length | 51678 |
| Sequence Checksum | 7c58b9d81ecca74c6fbc9701e3dfae79 |
| Sequence Coordinates | Pa01:22878885..22930562- |
Annotations
| Term | Name | Definition |
|---|---|---|
| There are no annotations of this type | ||
Relationship

| Relationships |
|---|
| The mRNA, Pa01g1564.8, is a part of gene, Pa01g1564. |
| The mRNA, Pa01g1564.6, is a part of gene, Pa01g1564. |
| The mRNA, Pa01g1564.2, is a part of gene, Pa01g1564. |
| The mRNA, Pa01g1564.5, is a part of gene, Pa01g1564. |
| The mRNA, Pa01g1564.3, is a part of gene, Pa01g1564. |
| The mRNA, Pa01g1564.7, is a part of gene, Pa01g1564. |
| The mRNA, Pa01g1564.4, is a part of gene, Pa01g1564. |
| The mRNA, Pa01g1564.1, is a part of gene, Pa01g1564. |

Transcripts
| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| Pa01g1564.1 | Pa01g1564.1 | mRNA | Pa01:22878884..22882343 |
| Pa01g1564.4 | Pa01g1564.4 | mRNA | Pa01:22878884..22930562 |
| Pa01g1564.7 | Pa01g1564.7 | mRNA | Pa01:22878884..22930562 |
| Pa01g1564.3 | Pa01g1564.3 | mRNA | Pa01:22878884..22930562 |
| Pa01g1564.5 | Pa01g1564.5 | mRNA | Pa01:22878884..22930562 |
| Pa01g1564.2 | Pa01g1564.2 | mRNA | Pa01:22878884..22930562 |
| Pa01g1564.6 | Pa01g1564.6 | mRNA | Pa01:22878884..22930562 |
| Pa01g1564.8 | Pa01g1564.8 | mRNA | Pa01:22920018..22930085 |