Summary
| Resource Type | Gene |
|---|---|
| Accession | |
| Organism | |
| Name | Pa01g3677 |
| Identifier | Pa01g3677 |
| Is Analysis | No |
| Is Obsolete | No |
| Time Accessioned | Friday, October 2, 2026 - 15:43 |
| Time Last Modified | Friday, October 2, 2026 - 15:43 |
Sequences
| Sequence | ATGGTGGCCATCCTCGGTGCACGGTACGCTCTTCTTTCCTCTCCCCTTCT |
|---|---|
| Sequence Length | 22753 |
| Sequence Checksum | 88c358f04e15fb145a594f6e724ad8f2 |
| Sequence Coordinates | Pa01:85703259..85726011+ |
Annotations
| Term | Name | Definition |
|---|---|---|
| There are no annotations of this type | ||
Relationship

| Relationships |
|---|
| The mRNA, Pa01g3677.1, is a part of gene, Pa01g3677. |
| The mRNA, Pa01g3677.2, is a part of gene, Pa01g3677. |
| The mRNA, Pa01g3677.4, is a part of gene, Pa01g3677. |
| The mRNA, Pa01g3677.3, is a part of gene, Pa01g3677. |
| The mRNA, Pa01g3677.5, is a part of gene, Pa01g3677. |
| The mRNA, Pa01g3677.6, is a part of gene, Pa01g3677. |

Transcripts
| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| Pa01g3677.1 | Pa01g3677.1 | mRNA | Pa01:85703258..85710675 |
| Pa01g3677.2 | Pa01g3677.2 | mRNA | Pa01:85703258..85716790 |
| Pa01g3677.4 | Pa01g3677.4 | mRNA | Pa01:85712330..85726011 |
| Pa01g3677.3 | Pa01g3677.3 | mRNA | Pa01:85712330..85726011 |
| Pa01g3677.5 | Pa01g3677.5 | mRNA | Pa01:85724430..85726011 |
| Pa01g3677.6 | Pa01g3677.6 | mRNA | Pa01:85725478..85726011 |