Summary
| Resource Type | Gene |
|---|---|
| Accession | |
| Organism | |
| Name | Pa01g4449 |
| Identifier | Pa01g4449 |
| Is Analysis | No |
| Is Obsolete | No |
| Time Accessioned | Sunday, October 4, 2026 - 11:13 |
| Time Last Modified | Sunday, October 4, 2026 - 11:13 |
Sequences
| Sequence | ATGCCTCGTAAAGTAAGCTATGGAGTTGATTATGGTGAAGACTATGATGA |
|---|---|
| Sequence Length | 33451 |
| Sequence Checksum | e09b4b76034f100eb6cc2cf4bc3819fb |
| Sequence Coordinates | Pa01:96177871..96211321- |
Annotations
| Term | Name | Definition |
|---|---|---|
| There are no annotations of this type | ||
Relationship

| Relationships |
|---|
| The mRNA, Pa01g4449.6, is a part of gene, Pa01g4449. |
| The mRNA, Pa01g4449.3, is a part of gene, Pa01g4449. |
| The mRNA, Pa01g4449.1, is a part of gene, Pa01g4449. |
| The mRNA, Pa01g4449.5, is a part of gene, Pa01g4449. |
| The mRNA, Pa01g4449.2, is a part of gene, Pa01g4449. |
| The mRNA, Pa01g4449.4, is a part of gene, Pa01g4449. |

Transcripts
| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| Pa01g4449.4 | Pa01g4449.4 | mRNA | Pa01:96177870..96211321 |
| Pa01g4449.2 | Pa01g4449.2 | mRNA | Pa01:96177870..96211321 |
| Pa01g4449.5 | Pa01g4449.5 | mRNA | Pa01:96177870..96211321 |
| Pa01g4449.1 | Pa01g4449.1 | mRNA | Pa01:96177870..96211321 |
| Pa01g4449.3 | Pa01g4449.3 | mRNA | Pa01:96177870..96211321 |
| Pa01g4449.6 | Pa01g4449.6 | mRNA | Pa01:96177870..96211321 |