Summary
| Resource Type | Gene |
|---|---|
| Accession | |
| Organism | |
| Name | Pa02g3456 |
| Identifier | Pa02g3456 |
| Is Analysis | No |
| Is Obsolete | No |
| Time Accessioned | Thursday, October 1, 2026 - 21:11 |
| Time Last Modified | Thursday, October 1, 2026 - 21:11 |
Sequences
| Sequence | ATGGCTTCTATGGTTGATTCTGCATTCATCCAAGCCTCCGAGCACAGGCC |
|---|---|
| Sequence Length | 21152 |
| Sequence Checksum | 504b6d9a9ca3f07bd3b42e72f9572263 |
| Sequence Coordinates | Pa02:84420722..84441873- |
Annotations
| Term | Name | Definition |
|---|---|---|
| There are no annotations of this type | ||
Relationship

| Relationships |
|---|
| The mRNA, Pa02g3456.6, is a part of gene, Pa02g3456. |
| The mRNA, Pa02g3456.5, is a part of gene, Pa02g3456. |
| The mRNA, Pa02g3456.4, is a part of gene, Pa02g3456. |
| The mRNA, Pa02g3456.3, is a part of gene, Pa02g3456. |
| The mRNA, Pa02g3456.2, is a part of gene, Pa02g3456. |
| The mRNA, Pa02g3456.1, is a part of gene, Pa02g3456. |

Transcripts
| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| Pa02g3456.1 | Pa02g3456.1 | mRNA | Pa02:84420721..84424752 |
| Pa02g3456.2 | Pa02g3456.2 | mRNA | Pa02:84420721..84432230 |
| Pa02g3456.3 | Pa02g3456.3 | mRNA | Pa02:84427535..84432230 |
| Pa02g3456.4 | Pa02g3456.4 | mRNA | Pa02:84427535..84441873 |
| Pa02g3456.5 | Pa02g3456.5 | mRNA | Pa02:84427535..84441873 |
| Pa02g3456.6 | Pa02g3456.6 | mRNA | Pa02:84437196..84441873 |