Summary
| Resource Type | Gene |
|---|---|
| Accession | |
| Organism | |
| Name | Pa07g1920 |
| Identifier | Pa07g1920 |
| Is Analysis | No |
| Is Obsolete | No |
| Time Accessioned | Thursday, October 1, 2026 - 01:35 |
| Time Last Modified | Thursday, October 1, 2026 - 01:35 |
Sequences
| Sequence | ATGGGCTACATCGGGCCTCATGGGGTCAATGCCTTACACAAATACAAATA |
|---|---|
| Sequence Length | 81583 |
| Sequence Checksum | 93b3b5bccffe6b3acb2bcdbab6548159 |
| Sequence Coordinates | Pa07:31833175..31914757+ |
Annotations
| Term | Name | Definition |
|---|---|---|
| There are no annotations of this type | ||
Relationship

| Relationships |
|---|
| The mRNA, Pa07g1920.4, is a part of gene, Pa07g1920. |
| The mRNA, Pa07g1920.1, is a part of gene, Pa07g1920. |
| The mRNA, Pa07g1920.3, is a part of gene, Pa07g1920. |
| The mRNA, Pa07g1920.2, is a part of gene, Pa07g1920. |
| The mRNA, Pa07g1920.6, is a part of gene, Pa07g1920. |
| The mRNA, Pa07g1920.5, is a part of gene, Pa07g1920. |

Transcripts
| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| Pa07g1920.4 | Pa07g1920.4 | mRNA | Pa07:31833174..31914757 |
| Pa07g1920.1 | Pa07g1920.1 | mRNA | Pa07:31833174..31914757 |
| Pa07g1920.3 | Pa07g1920.3 | mRNA | Pa07:31833174..31914757 |
| Pa07g1920.2 | Pa07g1920.2 | mRNA | Pa07:31833174..31914757 |
| Pa07g1920.6 | Pa07g1920.6 | mRNA | Pa07:31833306..31914757 |
| Pa07g1920.5 | Pa07g1920.5 | mRNA | Pa07:31833306..31914757 |