Summary
| Resource Type | Gene |
|---|---|
| Accession | |
| Organism | |
| Name | Pa08g0823 |
| Identifier | Pa08g0823 |
| Is Analysis | No |
| Is Obsolete | No |
| Time Accessioned | Saturday, October 3, 2026 - 22:45 |
| Time Last Modified | Saturday, October 3, 2026 - 22:45 |
Sequences
| Sequence | ATGGAGCTCTGGTTCCTCATCTTCATCTCCTCCCTCTCTATCTTTCTGGC |
|---|---|
| Sequence Length | 184713 |
| Sequence Checksum | 97773fc2316c84c2186ae719dcecffce |
| Sequence Coordinates | Pa08:13137807..13322519- |
Annotations
| Term | Name | Definition |
|---|---|---|
| There are no annotations of this type | ||
Relationship

| Relationships |
|---|
| The mRNA, Pa08g0823.7, is a part of gene, Pa08g0823. |
| The mRNA, Pa08g0823.6, is a part of gene, Pa08g0823. |
| The mRNA, Pa08g0823.5, is a part of gene, Pa08g0823. |
| The mRNA, Pa08g0823.4, is a part of gene, Pa08g0823. |
| The mRNA, Pa08g0823.3, is a part of gene, Pa08g0823. |
| The mRNA, Pa08g0823.2, is a part of gene, Pa08g0823. |
| The mRNA, Pa08g0823.1, is a part of gene, Pa08g0823. |

Transcripts
| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| Pa08g0823.1 | Pa08g0823.1 | mRNA | Pa08:13137806..13139351 |
| Pa08g0823.2 | Pa08g0823.2 | mRNA | Pa08:13137806..13269592 |
| Pa08g0823.3 | Pa08g0823.3 | mRNA | Pa08:13164635..13166177 |
| Pa08g0823.4 | Pa08g0823.4 | mRNA | Pa08:13164635..13269592 |
| Pa08g0823.5 | Pa08g0823.5 | mRNA | Pa08:13268050..13269592 |
| Pa08g0823.6 | Pa08g0823.6 | mRNA | Pa08:13268050..13322519 |
| Pa08g0823.7 | Pa08g0823.7 | mRNA | Pa08:13320977..13322519 |