Summary
| Resource Type | Gene |
|---|---|
| Accession | |
| Organism | |
| Name | Pa12g2262 |
| Identifier | Pa12g2262 |
| Is Analysis | No |
| Is Obsolete | No |
| Time Accessioned | Friday, October 2, 2026 - 21:44 |
| Time Last Modified | Friday, October 2, 2026 - 21:44 |
Sequences
| Sequence | ATGGCTACCATGGCTCTCTCTTCTCCCTCTTTGGCCGGAAAGGCCCTCAA |
|---|---|
| Sequence Length | 15938 |
| Sequence Checksum | 2ebf671d95d1ea2d50dab0b1857c1298 |
| Sequence Coordinates | Pa12:46541743..46557680- |
Annotations
| Term | Name | Definition |
|---|---|---|
| There are no annotations of this type | ||
Relationship

| Relationships |
|---|
| The mRNA, Pa12g2262.8, is a part of gene, Pa12g2262. |
| The mRNA, Pa12g2262.7, is a part of gene, Pa12g2262. |
| The mRNA, Pa12g2262.6, is a part of gene, Pa12g2262. |
| The mRNA, Pa12g2262.5, is a part of gene, Pa12g2262. |
| The mRNA, Pa12g2262.4, is a part of gene, Pa12g2262. |
| The mRNA, Pa12g2262.3, is a part of gene, Pa12g2262. |
| The mRNA, Pa12g2262.2, is a part of gene, Pa12g2262. |
| The mRNA, Pa12g2262.1, is a part of gene, Pa12g2262. |

Transcripts
| Transcript Name | Identifier | Type | Location |
|---|---|---|---|
| Pa12g2262.1 | Pa12g2262.1 | mRNA | Pa12:46541742..46547505 |
| Pa12g2262.2 | Pa12g2262.2 | mRNA | Pa12:46541742..46547505 |
| Pa12g2262.3 | Pa12g2262.3 | mRNA | Pa12:46546707..46557680 |
| Pa12g2262.4 | Pa12g2262.4 | mRNA | Pa12:46550127..46550925 |
| Pa12g2262.5 | Pa12g2262.5 | mRNA | Pa12:46550127..46557680 |
| Pa12g2262.6 | Pa12g2262.6 | mRNA | Pa12:46550127..46557680 |
| Pa12g2262.7 | Pa12g2262.7 | mRNA | Pa12:46553320..46554118 |
| Pa12g2262.8 | Pa12g2262.8 | mRNA | Pa12:46556882..46557680 |